Welcome to Okay.so, where you can ask questions and receive answers from other members of the community.

polypeptide sequence

mRNA, Polypeptide, Deletion of Base question..
Need Biology Tutoring.
what specifies the sequence of amino acids in a growing polypeptide?
IF DNA is AGGATCCGATTCATTGCA what is the mRNA sequence, and what is the polypeptide sequence?? helllllllllllp?
What would the polypeptide form this sequence?
When a gene transcription occurs what is produced?
A portion of a specific DNA molecule consists of the following sequence of nucleotide triplets:?
how is the amino acid sequence?
Please help me understand.
The sequence of amino acids in a polypeptide is the?
Translate the following sequence into polypeptide sequence -ATG-TGG-GTA-ACA-?
TAC CTT TCT AAA TAT ACC ACT?
What is the amino acid sequence of the polypeptide produced according to this DNA information?
Eukaryotic translation takes place in many steps. Which of the following represents the first step?
The coding regions of a gene (the portions that expressed as polypeptide sequences) called what?
Which statement best describes a eukaryotic chromosome?
A possible sequence of nucleotides in the template strand of DNA that would code for the polypeptide sequence.
what is the polypeptide GLY ILE VAL GLU GLN CYS CYS THR SER ILE CYS SER LEU?
MRNA to polypeptide code? I am having trouble finding this code.
Amino acid sequence of the polypeptide produced from a mRNA strand?
Analyzing Point Mutations Help!!
How to find the amino acid?
TAC CGT TCT GCT AAA TAT ACC ACT?
how to find charge of amino acid sequence?
Final one that's needed?
How many nucleotides...
Polypeptide is one continuous sequence of amino acids. Does it have quaternary structure? Why or why not?
What is the answer to my biology problem?
GCSE Biology B2 Question ?
base sequence of gene coding for polypeptide?
Please help me with biology?
I need help with my biology exam that is tomorrow!!! Its about polypeptides!
Why has it been said that polypeptide sequences co-linear with DNA sequences?
True or false!! Biology question!!
Which one of the following structures will be coded for by the shortest sequence of DNA?
A new organism is discovered in the forests of Costa Rica.
do the "universal translation codon" code for an amino acid?
We would expect that a 15-nucleotide sequence will direct the production of a polypeptide that consists of?
Biology help ASAP please.!
I need help with these questions?
AP Bio Help!!!
cell biology! please help!
Was the beginning or middle of this polypeptide sequence cloned?
How would i write the amino sequence of a polypeptide?
More biology?
question about TRNA :)?
Science Questions !!!!(:?
what is a short sequence of DNA that codes for a specific polypeptide called?
(DNA/RNA/GENETIC CODE) Biology help PLEASE!
Which one of the following is false?
Very confusing Biology question help?
PLEASE HELP! Polypeptide sequence!! [AP Bio]?
While writing the amino sequence of a polypeptide, should I stop when I get to a stop condon, or keep going?
Bio 12 question on polypeptide?
Anyone would like to please help me?
protein synthesis...nucleic acids?
Frameshift mutations can result in significant changes to the amino acid sequence in a polypeptide. Why?
if a T is inserted to the DNA template sequence after the third base?
Chemistry Help..Please Help?
Of the following, which is the most current description of a gene?
help with DNA sequence/ mRNA, and polypeptide?
I need help with genetics!
we would expect that a 15-nucleotide sequence will direct the production of a polypeptide that consists of?
Comp and Contrast Translation and Transcription?
If tRNA have only one anti-codon sequence, how do they create a polypeptide chain with different amnino acids?
What the structures of primary transcript, and the mRNA....
Some questions please answer?
biology h/w essay ! please help !
In transcription.....
How do you translate a polypeptide sequence specified by the mRNA?
how many amino acids will be in the polypeptide that is initialy formed when this mRNA sequence is translated?
Using Figure 17.5 in your textbook, identify a 59 S39 sequence of nucleotides in the DNA template strand...
How is the rearrangement of exons during splicing controlled?
Which of the following statements is incorrect (multiple choice)?
What the structures of primary transcript, and the mRNA....
IF DNA is AGGATCCGATTCATTGCA what is the mRNA sequence, and what is the polypeptide sequence?? helllllllllllp?
Excluding the stop sequence, how many nucleotides necessary to code for a polypeptide that is 100 amino ac
what specifies the sequence of amino acids in a growing polypeptide?
Proteins differ from one another because? for right answer!
template strand 3’ TAC GCA AGC AAT ACC GAC GAA 5’?
How is DNA Sequencing Done ? Please help !!
Biology Polypeptide Homework help
how do you draw a silk protein peptide sequence : glycine, serine. glycine. alanine, glycine and alanine? ?
genetics amino acid sequence homework question?
Frameshift mutations can result in significant changes to the amino acid sequence in a polypeptide. Why?
A repeating polymer with the sequence, 5’-GUAGUAGUAGUA…3’?
the DNA sequence for one small segment of a gene is: ATG,GCG,TAT,GAC,CTA?
Which of the following represents the correct sequence of events leading from gene to protein?
Number of proteins made from x number of amino acids?
How would I write the amino acid sequence of the polypeptide?
UCA, CCA, GGG, UAU, ACC?
What is the overall charge for the following polypeptide sequence?
Biology HELP!! LAB DUE!!! paper plasmid lab! What roles would restirciton enzymes play in nature?
Describe the steps in the synthesis of this polypeptide?
Using Figure 17.5 in your textbook, identify a 59 S39 sequence of nucleotides in the DNA template strand...
Indicate the possible sequences of mRNA codons that code for the following polypeptide?
which of the following determines the amino acid sequence of a polypeptide?
Amino acid sequence of the polypeptide produced from a mRNA strand?
for the DNA sequence TACCAAGTGAAAATT, what is the RNA transcript and the sequence of the polypeptide it codes?
a portion of a specific DNA molecule consists of the following sequence of nucleotide triplets?
which DNA base sequence could provide the code for this section of polypeptide?
to successfully complete translation, the BLANK responsible for carrying amino?
Translation is the conversion of the RNA sequence of enzymes into a polypeptide sequence.
The quaternary level of protein structure _____.
DNA sequence and polypeptide HELP!
what specifies the sequence of amino acids in growing polypeptide?
Which of the following statements regarding the flow of genetic information is false?
biology h/w essay !! plz help ?
The coding regions of a gene (the portions that expressed as polypeptide sequences) called what?
Chemistry help, T & F, Choice answer, 5 starts to best answer!
Can someone please check my work on translating polypeptide?
A portion of specific DNA molecule consists of the following sequence of nucleotide triplets.
NEED HELP: How is the polypeptide sequence of a protein transferred from the DNA molecule to the protein?
The base sequence of RNA is _____ to the DNA from which it is transcribed.
Beadle and Tatum proposed the following concept: One gene-One enzyme. The hypothesis could be restated as?
A portion of specific DNA molecule consists of the following sequence of nucleotide triplets.
Which one of the following structures will be coded for by the shortest sequence of DNA?
Which of the following statements regarding the flow of genetic information is false?
Islet cells in the pancreas secrete insulin, which is a protein. Which of the following is a correct sequence?
Indicate the mRNA (codon) sequence for the polypeptide Met-Ala-Ile-Glu-Leu-Phe. Help!
Suppose a gene has the base sequence AUGGGCCAGAACThe polypeptide encoded by this gene has how many amino acids?
Part of a mRNA molecule is shown below with the first few amino acids of the polypeptide it codes ..
CHECK AND HELP PLEASE DNA SEQUENCE TO mRNA STRAND QUESTIONS?
Since DNA is double-stranded, isn't one strand a waste since it codes for nothing?
how do i explain how the amino acid sequence of a polypeptide ultimately determines the function of a protein?
What is the answer to my biology problem?
the _____ _____ URE of a protein refers to the linear sequence of amino acids in a polypeptide.
Ap Bio hw help ! please?
DNA Base Sequence QUESTIONS?
A possible sequence of nucleotides in the template strand of DNA that would code for the polypeptide...
What would the finished polypeptide sequence be of 3'AATCGAGGAAGCACTGTA'5 DNA sequence?
We would expect that a 15-nucleotide sequence will direct the production of a polypeptide that consists of?
what would be the amino acid sequence for AUG CCG UAG GGG UUT GCG UAC?
how many amino acids will be in the polypeptide that is initialy formed when this mRNA sequence is translated?
Can someone explain the steps to this?
Help with Biology: Question on Protein Synthesis?
how many amino acids will be in the polypeptide that is initially formed when the mRNA sequence is translated?
Translation is the conversion of the RNA sequence of enzymes into a polypeptide sequence.
help me with finding polypeptide sequence Phe-Pro-Lys?
Explain at least two reasons why the following definition of a gene is inadequate?
The correct sequence in the synthesis of polypeptides from DNA is:?
What polypeptide would be produced?
biology essay word count help !!! plz help!
how many amino acids will be in the polypeptide thah is initally formed when this mRNA sequence is translated?
What is the overall charge for the following polypeptide sequence?
what is a short sequence of DNA that codes for a specific polypeptide called?
Why there more polypeptide sequences in comparison of genes in the human genome?
What is the Amino acid sequence of the polypeptide as a result of translation of mRNA codons?
Can you guys help me on some bio answers?
Indicate the possible sequences of mRNA codons that code for the following polypeptide?
What is the portion of protein synthesis that takes place at ribosomes and that uses the codons in mRNA...
Translate the following sequence into polypeptide sequence -ATG-TGG-GTA-ACA-?
Please please please help me :(?
Please help answer this DNA polypeptide chain!!
If I'm given a genetic code, how can I determine the DNA sequence that codes for the polypeptide sequence?
Bio 12 question on polypeptide?
Indicate the mRNA (codon) sequence for the polypeptide Met-Ala-Ile-Glu-Leu-Phe. Help!
Translate the following sequence into polypeptide sequence.
Which of the following is required if a researcher wants to yze genes in different species...
DOES ANYONE HAVE A CLUE?
Please help me with this DNA question?
genetics DNA sequence please help!
The primary structure of a protein is...
If this gene codes for a polypeptide that contains 3 tryptophans, which strand is transcribed?
Why is this definition of a gene inadequate?
we would expect that a 15-nucleotide sequence will direct the production of a polypeptide that consists of?
polymer is made that has a random sequence consisting?
PLEASE HELP URGENT BIO QUESTIONS 10 POINTS !!! :)?
What DNA sequence will code for the following polypeptide chain?
Relationship between Codons & Amino Acids.... See Below.
what is the corect sequence in translation?
What polypeptide chain will form from this sequence 5’ -AGGTTTAACGTGCAT-3’?
explain the relationship between the sequence of nucleotides and the amino aciid sequence in a polypeptide?
One biochemistry question (amino acid sequence)?
sequence of nucleotides that code for polypeptide sequence phe-met-glu-arg?
Help doing this Biology question?
Given the following molecule of DNA. Determine both the mRNA and amino acid sequence that will be produced. Be?
The 3-D structure of a polypeptide is determined by its amino acid sequence. Interactions of the amino acid s?
Nearly every polypeptide chain that is made by the ribosome begins with the RNA sequence ___, which codes for?
The DNA sequence for one small segment of a gene is shown below?
how does the sequence of amino acids in a polypeptide chain determine the 3d shape of a functional protein?
In the structural organization of many eukaryotic genes, individual exons may be related to which?
Which of the following statements best describes an anti-codon:?
How do I find the mRNA sequence of this partial cDNA sequence?
to successfully complete translation, the BLANK responsible for carrying amino?
When a gene transcription occurs what is produced?
what determines the primary structure of a polypeptide?
PLEASE HELP FILL IN THE BLANK.the process of translation occurs in the cytoplasm?
What polypeptide chain will form from this sequence 5’ -AGGTTTAACGTGCAT-3’?
some science help please? im real confused?
Choose the answer that has these events of protein synthesis in the proper sequence.
What DNA sequence will code for the following polypeptide chain?
Studying for Bio111 Final...
polypeptide sequencing..
Enter the letter of the item from column 2 that best matches the type of mutation in column 1.
Protein Synthesis Question, please help me!
after one amino acid is attached by a peptide bond onto the growing polypeptide chain, the ribosome?
How would I write the amino acid sequence of the polypeptide?
Of the following, which is the most current description of a gene? ?
describe the way in which the nucleotide sequence codes for the amino acid sequence in a polypeptide?
what would be the amino acid sequence for AUG CCG UAG GGG UUT GCG UAC?
What the atructures of the primary transcript, and the mRNA made from this template DNA?
Consider the polypeptide sequence encoded by the following DNA: TACAAAGAAATT If base number 6 is changed......
Does this sequence of bacterial DNA code for a polypeptide of exactly 10 amino acids?
What polypeptide would be produced from translation of mRNA?
For the DNA sequence TACCAAGTGAAAATT?
Is there a term for an enzyme that can cut at multiple sites of a protein?
why can the same polypeptide be synthesized if....
Can someone please check my work on translating polypeptide?
synthesis of the polypeptide?
Question about tRNAs?
The correct sequence in the synthesis of polypeptides from DNA is:?
Help with biology genetics question:Sequence of the DNA template strand is 5’TACTCATGGGTGTTGCATACT3’?
Genetics Calculation...........
The coding strand of a DNA sequence reads AATGCGCTTCATTAAATTA) ?
Is there any database that can yze peptide sequences and predict if a peptide can homodimerize?
What would be the correct sequence for a Polypeptide amino acid?
Help with dna and mrna sequencing?
Need help w amino acid sequence please!!!! 10 pts!!!
A portion of a specific DNA molecule consists of the following sequence of nucleotide triplets:?
Which statement is false?
DNA Base Sequence QUESTIONS?
Biology 101 questions?
Polypeptide sequencing question?
A possible sequence of nucleotides in the template strand of DNA that would code for the polypeptide...
How many DNA sequence can encode this polypeptide?
By fusing polypeptide-coding portions of eukaryotic DNA with bacterial promoter sequences, one ensures:?
what determines the sequence of amino acids in a polypeptide?
which of the following would have the greatest effect on an organism?
A possible sequence of DNA that would code for the polypeptide sequence Tyr-Lys-Cys-Gly would be what?
Explain how the sequence of amino acids in a polypeptide chain determines the 3-dimenisional shape of a fun...
Could you find out the protein lacking the signal sequence during synthesis?
How do I get the amino acid sequence for the polypeptide that would be synthesized using a genetic code table?
Whene a gene transcription occurs, which of the following is produced?
The linear sequence of monomers in a polypeptide chain is referred to as its ______ structure.
We would expect that a 15-nucleotide sequence will direct the production of a polypeptide that consists of?
What is the process that determines the sequence in which amino acids linked together to form polypeptide?
The primary structure of a protein is?
PLEASE HELP FILL IN THE BLANK.the process of translation occurs in the cytoplasm?
Errors in DNA replications!!! I can not understand it. Please help!
Arrange the following three types of cell junctions in order of least to greatest intercellular space: desmoso?
The DNA sequence for one small segment of a gene is shown below?
Biology- Frame-shift Mutations?
A new organism is discovered in the forests of Costa Rica.
A gene mutation is defined as a change in the?
Explain the significance of a change (mutation) in one letter of the base sequence of a gene as it related to-?
A portion of a specific DNA molecule consists of the following sequence of nucleotide triplets:?
DNA Translation Question?
Explain how a strand of mRNA results in specific sequence of amino acids in polypeptide.
Genetic information is encoded in the?
The information for the sequence of amino acids for polypeptide is carried by the:?
Artificial RNA with a known base sequence was added to a medium containing bacterial ribosomes and a mixture o?
How does a strand of mRNA result in a specific sequence of amino acids in a polypeptide?
Describe the steps in the synthesis of this polypeptide?
A portion of a specific DNA molecule consists of the following sequence of nucleotide triplets:?
what happens in translation?
What is the amino acid sequence of the polypeptide produced according to this DNA information?
5' AUGGGG UUUAUA UAUACA CGGAAA AAGUAA 3'?
How many nucleotides necessary to code for a polypeptide that is 100 amino acids long?
Biology: nucleotide sequence of DNA. Please help I'm desperate?
A possible sequence of DNA that would code for the polypeptide sequence Tyr-Lys-Cys-Gly would be what?
A portion of a specific DNA molecule consists of the following seq. of nucleotide triplets:TAC GAA CTT CGC?
the _____ _____ URE of a protein refers to the linear sequence of amino acids in a polypeptide.
The linear sequence of monomers in a polypeptide chain is referred to as its ______ structure.
Given the following sequence of mRNA below, what would be the resulting polypeptide?
state that a gene is a sequence of nucleotides as part of a DNA molecule, which codes for a polypeptide?
Which one of the following is an example of secondary structure in a protein?
How to read polypeptide chain sequence?
what is the relationship between a codon and an amino acid?
how do you draw a silk protein peptide sequence : glycine, serine. glycine. alanine, glycine and alanine? ?
A linear stretch of DNA that specifies the sequence of amino acids in a polypeptide chain is called a?
If tRNA have only one anti-codon sequence, how do they create a polypeptide chain with different amnino acids?
Biology Anyone?
Choose the answer that has these events of protein synthesis in the proper sequence. Thanks tons!
Second Law of Thermodynamics?
Protein Synthesis Questions!
Need help with RNA question!! -Thanks?
I need help deciphering this strand of DNA.
which of the following determines the amino acid sequence of a polypeptide?
biology questions! genetic code?
Help with microbiology genetics?
Beadle and Tatum proposed the one gene-one enzyme concept. This can modernly be explained in which way?
In an enzyme or Tertiary structure, what bonds there?
The nucleotide sequence A G U G A C C A A could represent:?
Help with biology genetics question:Sequence of the DNA template strand is 5’TACTCATGGGTGTTGCATACT3’?
A possible sequence of nucleotides in the template strand of DNA that would code for the polypeptide...
what determines the primary structure of a polypeptide?
Which one of the following is false? (Biology Question)?
what is the corect sequence in translation?
"what determines the sequence in which amino acids embled to form a specific polypeptide?"?
What determines the primary structure of a protein?
true/false: genes/proteins/dna/rna?
Beadle and Tatum proposed the following concept: One gene-One enzyme. The hypothesis could be restated as?
Which of the following can be accomplished by researchers who use advanced programming in the field of computa?
By fusing polypeptide-coding portions of eukaryotic DNA with bacterial promoter sequences, one ensures:?
How does a strand of mRNA result in a specific sequence of amino acids in a polypeptide?
We would expect that a 15-nucleotide sequence will direct the production of a polypeptide that consists of?
Proteins differ from one another because?
which DNA base sequence could provide the code for this section of polypeptide?
Need help with a biology question about DNA?
Indicate the possible sequences of mRNA codons that code for the following polypeptide:?
Complementary base pairs held together by...
A polypeptide is a sequence if protien or amino acids?
What is the Amino acid sequence of the polypeptide as a result of translation of mRNA codons?
The signal sequence that targets the polypeptide to the rough ER is rich in _______ amino acids.
biology homework?
Can anyone help me fill in the blanks, i have already done some, but am stuck!
Translate the following sequence into polypeptide sequence.
Can anyone help me with this chemistry question please?
Biology help... any help is appreciated.
A bio qu. on amino acids?
protein synthesis and nucleic acid questions?
If 100 Molecules of glycine covalently joined together in sequence, the single molecule that would result....
Excluding the stop sequence, how many nucleotides necessary to code for a polypeptide that is 100 amino ac
sequence of nucleotides that code for polypeptide sequence phe-met-glu-arg?
Using the following sequence of transcribed DNA, list the start/stop codon and the polypeptide sequence?
which is the most current description of a gene?
MRNA to polypeptide code? I am having trouble finding this code.
Arrange the following events in the proper sequence for a protein to be secreted.
A-Level Biology.....
Relate the structure of DNA and the importance of the DNA sequence to the functioning of the polypeptide?
What determines the primary structure of a protein?
for the DNA sequence TACCAAGTGAAAATT, what is the RNA transcript and the sequence of the polypeptide it codes?
how many amino acids will be in the polypeptide that is initially formed when the mRNA sequence is translated?
PROTEIN STRUCTURE help!!!!
By fusing polypeptide-coding portions of eukaryotic DNA with bacterial promoter sequences, one ensures:?
A partial hydrolysis of a protein yielded the following fragments?
Some more help plz... thx....
what specifies the sequence of amino acids in growing polypeptide?
Help with microbiology genetics?
Which one of the following statements about plant viruses is false?
how do i explain how the amino acid sequence of a polypeptide ultimately determines the function of a protein?
genetics amino acid sequence homework question?
Need help w amino acid sequence please!!!! 10 pts!!!
suppose a "mini gene" has the following base sequence: GATTACATTAAG. How many amino acids will be in the polyp?
Amino acid sequencing of a polypeptide indicates that the polypeptide consists of 7 amino acids....
Part of a mRNA molecule is shown below with the first few amino acids of the polypeptide it codes ..
question about dna codes?
why can the same polypeptide be synthesized if....
Wanna take a shot at THIS one?
How do you translate a polypeptide sequence specified by the mRNA?
DNA sequence HELP!!!
MicroBiology questions?
Why n’t amino acid sequences branched?
How do you translate sequences?
"what determines the sequence in which amino acids embled to form a specific polypeptide?"?
what is a gene this is a bio quiz?
Biology: nucleotide sequence of DNA. Please help I'm desperate?
How many nucleotides necessary to code for a polypeptide that is 100 amino acids long?
Original template strand: 3' TAC GCA AGC AAT ACC GAC GAA 5'?
Could you find out the protein lacking the signal sequence during synthesis?
HELP NEEDED NOW!!!! PLEASE>>>>PLEASE>>>GENETICS QUESTION>>>?
How does a change in the nucleotide sequence of a gene result in a change in the structure of the protein?
What is the polypeptide sequence after a nucleotide is deleted from the mRNA?
Biology Questions! Please Help I Am Stumped...
how many different possible sequences? Please Help!
Sickle Cell , explination?
Help with multiple choice molecular genetics problems please!!
You given the following DNA sequence which is the template for mRNA?
which is the correct sequence of polypeptide transport in the secretory pathway?
mRNA, Polypeptide, Deletion of Base question..
Which of the following represents the correct sequence of events leading from gene to protein?
Why can nuclear localization signals be found anywhere in a polypeptide?
How many nucleotides necessary to code for a polypeptide that is 100 amino acids long?
AP Biology question-Which of these statements is false?
if a T is inserted to the DNA template sequence after the third base?
How many DNA sequence can encode this polypeptide?
If one deletes or adds single nucleotide bases to a DNA sequence, what happens to the polypeptide?
What the atructures of the primary transcript, and the mRNA made from this template DNA?
Please help answer this DNA polypeptide chain!!
how is the amino acid sequence?
protein synthesis and nucleic acids?
Explain how the sequence of amino acids in a polypeptide chain determines the 3-dimensional shape of a functio?
How is this DNA Sequence done?
Does this sequence of bacterial DNA code for a polypeptide of exactly 10 amino acids?
The 3-D structure of a polypeptide is determined by its amino acid sequence. Interactions of the amino acid s?
suppose a "mini gene" has the following base sequence: GATTACATTAAG. How many amino acids will be in the polyp?
Biology 12, Mutations: Chromosomal and Gene?
If this gene codes for a polypeptide that contains 3 tryptophans, which strand is transcribed?
ANOTHER BIOLOGY QUESTION URGENT?
Biology Help please please.!
The secondary structure of a protein:?
While writing the amino sequence of a polypeptide, should I stop when I get to a stop condon, or keep going?
How do I find the mRNA sequence of this partial cDNA sequence?
Changes in a polypeptide following translation may involve?
A possible sequence of nucleotides in the template strand of DNA that would code for the polypeptide sequence.
1.The number of nucleotides in a codon is ?
when reading a DNA strand to determine stop and start codons do I read that from the mRNA sequence?
DNA sequence?
If exon is deleted and the starnd undergoes frameshift, what will be resulting mRNA sequence?
Did I leave anything out in my description of the role of RNAs in protein synthesis?
You given the following DNA sequence which is the template for mRNA?
protein synthesis and nucleic acids?
NEED HELP: How is the polypeptide sequence of a protein transferred from the DNA molecule to the protein?
Biology help with DNA?
Easy Biology question?
Biology Question??????????
Explain how the sequence of amino acids in a polypeptide chain determines the 3-dimensional shape of a functio?
biology quiz please help!!!
Protein synthesis questions.
PLEASE HELP! Polypeptide sequence!! [AP Bio]?
Which of the following would be more likely to be present on mRNA derived from prokaryotes?
By fusing polypeptide-coding portions of eukaryotic DNA with bacterial promoter sequences, one ensures:?
explain the relationship between the sequence of nucleotides and the amino aciid sequence in a polypeptide?
Explain how a strand of mRNA results in specific sequence of amino acids in polypeptide.
Is anyone good at biology?
How does tRNA interpret an RNA Template?
Why has it been said that polypeptide sequences co-linear with DNA sequences?
What is the process that determines the sequence in which amino acids linked together to form polypeptide?
How do I find the mRNA sequence of this partial cDNA sequence?
The coding strand of a DNA sequence reads AATGCGCTTCATTAAATTA) ?
During Transcription?
A possible sequence of nucleotides in the template strand of DNA that would code for the polypeptide...
polypeptide sequencing..
Polypeptide sequencing question?
Number of proteins made from x number of amino acids?
What is the complete sequence of amino acids in this polypeptide?
polymer is made that has a random sequence consisting?
Consider the polypeptide sequence encoded by the following DNA: TACAAAGAAATT If base number 6 is changed......
how does the sequence of amino acids in a polypeptide chain determine the 3-dimensional shape of a functual pr?
Changes in a polypeptide following translation may involve?
Which of the following is required if a researcher wants to yze genes in different species...
Nucleic acid - DNA - RNA - polypeptide?
example of a secondary strructure found in protein?
DNA sequence?
cell molecular biology?
how is the nucleotide sequence in the mRNA translated into polypeptide sequence?
Nearly every polypeptide chain that is made by the ribosome begins with the RNA sequence ___, which codes for?
Help! A question on mutations...
Which of the following would be more likely to be present on mRNA derived from prokaryotes?
I need help with these potential essay questions in biology?
Questions regarding mRNA synthesis?
DNA sequence and polypeptide HELP!
Biology queestions, need help.
How does tRNA interpret an RNA Template?
Of the following, which is the most current description of a gene?
which is the correct sequence of polypeptide transport in the secretory pathway?
protein synthesis fill in the blank home work?
The following codons and amino acids...
How is this DNA Sequence done?
the "primary structure" of a protein refers to...
What would be the correct sequence for a Polypeptide amino acid?
what determines the sequence of amino acids in a polypeptide?
The sequence of amino acids in a polypeptide is the?
Identify all of the following statements that true regarding microbial genetics?
Given the following molecule of DNA. Determine both the mRNA and amino acid sequence that will be produced. Be?
How many nucleotides necessary to code for a polypeptide that is 100 amino acids long?
How do I find the mRNA sequence of this partial cDNA sequence?
A linear stretch of DNA that specifies the sequence of amino acids in a polypeptide chain is called a?
Given the following sequence of mRNA below, what would be the resulting polypeptide?
What polypeptide would be produced from translation of mRNA?
What's the secondary structure of proteins?
Are these bad questions in Biology?
can someone help me with these bio questions?
For the DNA sequence TACCAAGTGAAAATT?
I need help with these questions?
What is an amino acid?
Choose the answer that has these events of protein synthesis in the proper sequence.
DNA Sequence?
Need help understanding this biology concept question?
Science Question (mRNA and DNA)?
DNA/RNA/Amino Acid help... (will give best answer)?
Biology Polypeptide Homework help
dna replication.............................…
What is the polypeptide sequence after a nucleotide is deleted from the mRNA?
a portion of a specific DNA molecule consists of the following sequence of nucleotide triplets?
Genetics, need help understanding how to do this?
Can anybody help?
please help?
synthesis of the polypeptide?
One biochemistry question (amino acid sequence)?
Help with a few biology questions?
How many amino acids will be in the polypeptide that is initially formed when the mRNA sequence is translated?
Polypeptide is one continuous sequence of amino acids. Does it have quaternary structure? Why or why not?
The primary structure of a protein is?
The signal sequence that targets the polypeptide to the rough ER is rich in _______ amino acids.
Help with genetics homework? codon dictionary and RNA/DNA sequencing?
If exon is deleted and the starnd undergoes frameshift, what will be resulting mRNA sequence?
Identifying Polypeptide sequences?
AP Biology Multiple Choice Help?
Proteins differ from one another because?
What's the secondary structure of proteins?
how is the nucleotide sequence in the mRNA translated into polypeptide sequence?
genetics DNA sequence please help!
A biochemistry question about amino acid sequences?
Atheists, Life is too complex to be a random event?
how many amino acids will be in the polypeptide thah is initally formed when this mRNA sequence is translated?
help me with finding polypeptide sequence Phe-Pro-Lys?
Gene mutation question?
what programs the amino acid sequence of a polypeptide?
The information for the sequence of amino acids for polypeptide is carried by the:?
How to determine whether a polypeptide is more likely to form an alpha helix at a a given pH?
How to read polypeptide chain sequence?
CAN SOMEONE HELP ME ON BIOLOGY?
help with DNA sequence/ mRNA, and polypeptide?
The nucleotide sequence A G U G A C C A A could represent:?
Arrange the following events in the proper sequence for a protein to be secreted.
I need Biology help covering Codons/DNA/Nucleotides. Thanks tons!!
Nucleotide insertion during Transcription?
what programs the amino acid sequence of a polypeptide?
Was the beginning or middle of this polypeptide sequence cloned?
Below is a template strand of DNA.
If 100 Molecules of glycine covalently joined together in sequence, the single molecule that would result....
Polypeptide chain question- chemistry/biology?
If six hundred amino acids were linked together in sequence, it would form a ?
By fusing polypeptide-coding portions of eukaryotic DNA with bacterial promoter sequences, one ensures:?
If six hundred amino acids were linked together in sequence, it would form a ?
You were told that genes code for proteins. Which statement below best indicates that genes specify amino acid?
Nucleotide insertion during Transcription?
Can the complete nucleotide sequence of a EUKARYOTIC protein-coding gene be worked out from the polypeptide se?
base sequence of gene coding for polypeptide?
state that a gene is a sequence of nucleotides as part of a DNA molecule, which codes for a polypeptide?
Nucleic acid - DNA - RNA - polypeptide?
By fusing polypeptide-coding portions of eukaryotic DNA with bacterial promoter sequences, one ensures:?
Amino Acid?
Biology genetic question, help!
Set of biology q's over DNA (multiple choice & short answer)?
How is DNA Sequencing Done ? Please help !!
how to find charge of amino acid sequence?
Why can nuclear localization signals be found anywhere in a polypeptide?
What is the answer to this question?(ten points for best answer!) Thanks!
what is the polypeptide GLY ILE VAL GLU GLN CYS CYS THR SER ILE CYS SER LEU?
Help need with codon question?
describe the way in which the nucleotide sequence codes for the amino acid sequence in a polypeptide?
Protein Synthesis...can someone help me on some questions from my biology homework?
What polypeptide would be produced?
Suppose a gene has the base sequence AUGGGCCAGAACThe polypeptide encoded by this gene has how many amino acids?
A polypeptide is a sequence if protien or amino acids?
CHECK AND HELP PLEASE DNA SEQUENCE TO mRNA STRAND QUESTIONS?
How does a change in the nucleotide sequence of a gene result in a change in the structure of the protein?
What polypeptide would be produced if the tenth base in the mRNA sequence had changed to ...
The role of DNa,biology homework help ???can you help me on question my teacher can't.
Proteins differ from one another because ?
Genetic information is encoded in the?
What is the complete sequence of amino acids in this polypeptide?
Biology Questions. Having to DO with DNA And RNA.
How would i write the amino sequence of a polypeptide?
The primary structure of a protein is?
what is the relationship between a codon and an amino acid?
Biology/genetics/DNA question?...
Which of the following statements about ribosomes is false?
help please answer what you know it counts as an exam!
Identifying Polypeptide sequences?
biology questions?
What would the finished polypeptide sequence be of 3'AATCGAGGAAGCACTGTA'5 DNA sequence?
The DNA sequence for one small segment of a gene is shown below?
Explain how the sequence of amino acids in a polypeptide chain determines the 3-dimenisional shape of a fun...
Eukaryotic translation takes place in many steps. Which of the following represents the first step?
questions on DNA molecules?
the DNA sequence for one small segment of a gene is: ATG,GCG,TAT,GAC,CTA?
question about proteins and amino acid sequences related to protein binding site?
The secondary structure of proteins refers to what?
The secondary structure of proteins refers to what?
Whene a gene transcription occurs, which of the following is produced?
Why there more polypeptide sequences in comparison of genes in the human genome?
Relate the structure of DNA and the importance of the DNA sequence to the functioning of the polypeptide?
DNA and RNA help!
Artificial RNA with a known base sequence was added to a medium containing bacterial ribosomes and a mixture o?
how does the sequence of amino acids in a polypeptide chain determine the 3-dimensional shape of a functual pr?
What would the polypeptide form this sequence?
PLEASE HELP URGENT BIO QUESTIONS 10 POINTS !!! :)?
Using the following sequence of transcribed DNA, list the start/stop codon and the polypeptide sequence?
when reading a DNA strand to determine stop and start codons do I read that from the mRNA sequence?
how can i make this short essay shorter ??? biology h/w?
If one deletes or adds single nucleotide bases to a DNA sequence, what happens to the polypeptide?
Please help me with these DNA sequencing problems?
If I'm given a genetic code, how can I determine the DNA sequence that codes for the polypeptide sequence?
Indicate the possible sequences of mRNA codons that code for the following polypeptide:?
Analyzing Point Mutations Help!!
I NEED HELP ON MY BIOLOGY HOMEWORK IMMEDIATELY?
mRNA sequencing....HELP?
how does the sequence of amino acids in a polypeptide chain determine the 3d shape of a functional protein?
The base sequence of RNA is _____ to the DNA from which it is transcribed.
How to determine whether a polypeptide is more likely to form an alpha helix at a a given pH?
Polypeptide chain question- chemistry/biology?
The complementary (inactive) DNA Strand for this active chain?
i need help in genetics..
I NEED HELP ON MY BIOLOGY HOMEWORK IMMEDIATELY?
Amino acid sequencing of a polypeptide indicates that the polypeptide consists of 7 amino acids....
Heeeeelp plzzz....
Protein Synthesis Question?
How many amino acids will be in the polypeptide that is initially formed when the mRNA sequence is translated?
Biology Question?
DNA Sequence?
after one amino acid is attached by a peptide bond onto the growing polypeptide chain, the ribosome?
DNA sequence HELP!!!
who likes bio? heres a question?
What polypeptide would be produced if the tenth base in the mRNA sequence had changed to ...
which of the following would have the greatest effect on an organism?
The liner sequence of nitrogenous _____ specifics the genetic words, which called genes.
Which of the following structure is stabilized by H-bonds?
List, in order, the tRNA anticodons that complementary to the mRNA sequence AUGCAUGCAAGUUAG. Also...
Can the complete nucleotide sequence of a EUKARYOTIC protein-coding gene be worked out from the polypeptide se?
How to find the amino acid?
The DNA sequence for one small segment of a gene is shown below?
List, in order, the tRNA anticodons that complementary to the mRNA sequence AUGCAUGCAAGUUAG. Also...
Bio help!!! PLEASE?
The liner sequence of nitrogenous _____ specifics the genetic words, which called genes.