Welcome to Okay.so, where you can ask questions and receive answers from other members of the community.

complementary strands

Complementary Strand of DNA?
does one strand of DNA offer enough clues for embling it's complementary strand?
Could someone help me write complementary mRNA strand with DNA?
For this DNA strand, what is the complementary DNA strand and the mRNA strand transcribed from it?
What is the complementary DNA strand of AATTGCATA?
Need help what is this DNA strands complementary sequence?
What does complementary mean in the biochemistry of DNA?
How to translate mRNA to tRNA?
What is a complementary strand?
whats the complementary strand of DNA when given one side of strand?
Ok, so I'm reading about DNA and I don't quite understand the process of replication?
2) If this is one strand of DNA: ATTGCGTCAATTACGCTA, what would its complementary strand be?
HELP with biology i need help finding the complementary strands to these template strands?
Write the DNA strand complementary to the following:TACTCT?
If one strand of DNA is TTAGGTCG, 1) then the sequence of complementary strand of DNA would be_.... Rna....!!
I have searched and researched and have no clue please help?
RNA complementary strand help?
What is the base sequence of the complementary strand of mRNA for the DNA strand with the following sequence?
The base sequence on one strand of DNA is AGATTCGC. The sequence of the complementary strand is _____________?
During DNA replication, _____.
The strict arrangement of base-pairings in the double helix results in two strand of nucleotides that ?
If six bases on one strand of DNA double helix AGTCGG, what the six bases on the complementary section?
Is the daughter/complementary strand of DNA the same as RNA?
Which sequence is an RNA strand complementary to the original DNA strand?
the attachment of nucleotides to form a complementary strand of Dna......................
What is the complementary DNA strand to this sequence: CATGGA?
Write out the complementary strand for this segment taken from a strand of DNA...??
Transcription produces RNA complementary to ...
Sequences of the bases in the two strands of DNA in relation to ends?
Which of the following is a correct complementary DNA strand to A-A-C-G-T-A-C?? please help?
What would be the complementary strand of DNA to this gene?
What is the correct complementary DNA strand for CCATCG?
please help with double stranded DNA denaturing and renaturing?
How to find the complementary strand of DNA that would form the double helix?
How do you put these steps of DNA replication in order?
Can there be a "T" in complementary mRNA strands?
Which of the following occurs first during the process of transcription?
What is the Complementary DNA strand for TACGGGACACTCGA?
9a) Assume that the nitrogen base sequence in one of the strands in a DNA molecule is:?
Write the DNA strand complementary to the following: TACTCT?
DNA braked into triplets. What would be the complementary strand read?
What would the RNA strand that would be complementary to the following DNA strand be?
what does it mean when a DNA strand is complementary?
what would be the base sequence for the complementary DNA formed from the strand of DNA shown below?
how two DNA strands complementary?
Write the complementary strand of the DNA for ATCGTGAC.
Write the complementary strand of the DNA for ATCGTGAC.
Nucleotides in opposing strands of DNA that bind to each other called?
Which of the following is NOT true about DNA replication?
What is the complementary bases for the following DNA strand ACG TCG TAG CTG?
During protein synthesis complementary base pairs come together?
How do leading and lagging strands work in DNA replication?
Write a complementary strand od dna from: ATGGGGCCCCTATTGTAA?
Biology questions: DNA?
again, to BIOLOGY people (About DNA)?
What is the matching mRNA strand?
Why is the “complementary” way the nitrogen bases combine in DNA important?
If one strand of a DNA molecule has the base sequence ATTGCAT, its complementary strand will have the sequence?
Complementary DNA sequence question?
What materials should I use and how should I set it up?
what would be the complementary strand of the DNA strand 5' ACTGAGGAGTAG 3'?
why does ssdna hybridise to a probe on a microarray and not to its original complementary strand?
If a DNA has the Adenine, quanine, adenine, thymine, what will the complementary strand look like?
Determine the complementary DNA strand (Strand B), indicating the 5’ and 3’ ends.
does DNA polymerase synthesize new nucleotides and join them complementary to the template strand?
What is the nucleotide sequence of this DNA strand?
Which of the following is NOT true of structure/function relationship of DNA?
One strand of a section of DNA reads:5' – TCGGACCTGAC – 3'. Which of the following would be the complementary?
Which one of the following statements best describes the replication of DNA?
The base sequence on one strand of DNA is AGATTCGC. The sequence of the complementary strand is _____________?
Difference between complementary and identical DNA strands?
If this is one strand of DNA: TACGCGTCAATAACGCTA, what would the sequence of bases in its complementary strand?
Is anyone good at chemistry? I've looked everywhere and read everthing and I cant find the answers to these.
the addition of nucleotides to form a complementary strand of dna..
How do you find the complementary bases ,nucleotides, for the DNA strand AATCGGATCGTTACC?
what would the complementary strand of DNA be for the following sequence of bases c t t a g g c t t a c c a th
What would the complementary strand of DNA be for the following sequence of bases? ACCTAGTTG urgent!!!!!!!!!
How to find the complementary strand of DNA that would form the double helix?
Which of the following is a very important step in PCR?
For this DNA strand, what is the complementary DNA strand and the mRNA strand transcribed from it?
The sequence pattern in which two complementary strands have the same sequence if they both read 5'?
What type of bond joins the bases of complementary DNA strands?
DNA complementary strand?
What would the complementary strand of DNA be if cttaggcacca was the sequence of bases?
DNA REPLICATION BIOLOGY PLEASE HELP?
Given one strand of DNA: CAT ACG TTC CTA AAG ACG ATT, what would its complementary strand be?
how is a complementary strand of dna made?
Below single strands of DNA nucleotides...
Predict the sequence of bases of the complementary strand to the nucleic acid?
What is the complementary bases for the following DNA strand ACG TCG TAG CTG?
DNA, I would like to see if I got it right?
A DNA strand with the sequence 3' GTGAACTGC 5' is complementary to the sequence?
need help what is this dna strands complementary sequence?
What would be the complementary strand to poly-nucleotide sequence of adenine-cytosine-guanine?
What is the complementary bases for the following DNA strand ACG TCG TAG CTG?
A DNA strand with the sequence 3' GTGAACTGC 5' is complementary to the sequence?
Help with genetics questions in biology?
If this is one strand of DNA: ATTGCGTCAATTACGCTA, what would its complementary strand be?
The polymerase chain reaction (PCR):?
Give the base sequence of the complementary DNA strand, T A C G C C A G T G G T T C G A T C .
During protein synthesis complementary base pairs come together?
an enzyme that uses dna as a template to synthesize a complementary RNA strand is called?
During DNA replication, a complementary strand..
Write a complementary strand of dna from: ATGGGGCCCCTATTGTAA?
What enzyme is used to synthesize a strand of cDNA (copy DNA) that is complementary to an mRNA template?
Write the complementary strand of DNA?
HELP PLEASE WITH THESE two BIOLOGY STRANDS?
DNA is held together as a duplex by hydrogen bonds. Why isn't this a fragile state of affairs for DNA?
Write the sequence of bases in the complementary mRNA strand?
Determine the complementary strand of a DNA sequence?
I need to get the DNA complementary strand the mRNA the tRNA and the polypeptide from this coding strand TACTG?
Which of the following is a DNA strand complementary to CGA ATC AGC?
If a piece of strand of DNA is TACGACTGATTAGTGGCAGGGAGAATT?
What does it mean when we say that DNA strands complementary?
Which one of the following statements best describes the replication of DNA?
what do complementary strands of the double helix serve as?
Primase synthesizes an RNA primer complementary to the leading strand correct?
What would be the sequence of bases on the complementary strand?
Can you guys help me with this take home quiz please?
What would the complementary DNA strand..
What components of a nucleotide strand form hydrogen bonds with their partner on a complementary strand?
DNA Strand (Complementary)?
A DNA strand with the sequence of GAATTCGGCA what is the complementary strand?
Why is the RNA molecule made up of only 1 strand? Please help?
if the sequence in a one strand of dna is GCCATTAG , what is the complementary strand?
What is the complementary DNA strand?
The double-helix structure of DNA is the result of?
5’- ATGCTATCATTGACCTTGAG*TTATTAA – 3 If DNA, what is the complementary strand?
On which strand of DNA, the actual template strand or complementary partner, does the TATA box sequence occur?
n a DNA double helix an adenine of one strand always pairs with a ? of the complementary strand, and a...
A sequence of a section of 1 of the 2 strands of DNA is TTACCG. What's d sequence of d corresponding region...
URGENT PLEASE HELP! Which strand of DNA would you use as a template to make raw mRNA?
Which of the following is a DNA strand complementary to CGA ATC AGC?
DNA strands in transcription?
Why the DNA duplex strands both antiparallel and complementary?
What is the sequence of the complementary strand of DNA? 5'ATGCACTGCCTTCTGGAATAG3'?
What would be the sequence of bases on the complementary strand?
9. Why don’t DNA template strands reanneal with one another during the annealing cycle of PCR?
Help with a protein sequence conversion?
RNA complementary strand help?
If one strand of DNA had the sequence TAGGTAC, what would be the sequence of the complementary DNA strand?
What's the difference between base pairs and complementary strands?
Which sequence is an RNA strand complementary to the original DNA strand?
If a DNA strand with the base sequence CAGCAT were to unzip and be replicated,?
DNA polymerase is ociated with which of the following?
If this is one strand of DNA: ATTGCGTCAATTACGCTA, what would its complementary strand be?
What would be the sequence of bases GGCAGTTCATGC on the complementary strand?
How the two dna strands complementary?
why does ssdna hybridise to a probe on a microarray and not to its original complementary strand?
What does complementary mean in the biochemistry of DNA?
RNA molecules destroyed if they have a sequence complementary to an introduced double stranded RNA is called..
What is an easy way of making complementary RNA strands from DNA?
Electrophoresis separates DNA fragments of different sizes, but this technique does not indicate which of the?
What is the coding strand for the Globin Gene?
Electrophoresis separates DNA fragments of different sizes, but this technique does not indicate which of the?
If one strand of the DNA reads 5'ATTGACCGTATAGACGT3', what would the complementary read?
How to fill in a complementary strand of DNA?
1. Suppose one of the strands in your paper DNA model has the following sequence of bases:?
A piece of single-stranded DNA that binds to complementary DNA in a particular region of the genome is called?
Given the following DNA sequence, determine the complementary strand that would be added in replication: ATTGC
In DNA replication, the term “unzipping” refers to?
Supose that a strand of DNA has the base sequence ATTCCG what is the base sequence of the complementary strand
What components of a nucleotide strand form hydrogen bonds with their partner on a complementary strand?
does one strand of DNA offer enough clues for embling it's complementary strand?
If a DNA has the Adenine, quanine, adenine, thymine, what will the complementary strand look like?
what is this complementary strand of this DNA?
Can there be a "T" in complementary mRNA strands?
what would the initial strand have to be if the complementary strand were CAT?
What would the complementary strand of DNA...
What would be the sequence of bases GGCAGTTCATGC on the complementary strand?
Why is the "complementary" way the nitrogen bases combine in DNA important?
If a DNA has the bases Adenine, guanine, adenine, thymine, what will the complementary strand look like?
1. Suppose one of the strands in your paper DNA model has the following sequence of bases:?
what would be the complementary strand of 5tm-ATT-GCG-TCA-ATT-ACG-CTA-3tm\?
Which of the following is a correct complementary DNA strand to A-A-C-G-T-A-C?? please help?
does DNA polymerase synthesize new nucleotides and join them complementary to the template strand?
how to deduce the base sequence of a complementary DNA strand when given a single stranded DNA template?
If one strand of DNA has the following nucleotide sequence, find the correct complementary strand. 5'-CATTAGAT?
If this is one strand of DNA: TACGCGTCAATAACGCTA, what would the sequence of bases in its complementary strand?
If one strand of DNA has the base sequence AAGCAA, the complementary strand has which of the following sequenc?
hw help?Which of the following is a good reason for mRNA to be single-stranded,instead of double like DNA?
dna sequence determine the complementary strand that would be added in replication attgcatgatagcc?
What is the DNA sequence to its complementary strand GGTACAAT?
Which of the following is NOT a step in transcription?
If one strand of DNA is TTAGGTCG, 1) then the sequence of complementary strand of DNA would be_.... Rna....!!
What would the RNA strand that would be complementary to the following DNA strand be?
a piece of single-stranded DNA that binds to complementary DNA in a particular region of the genome is called?
Write the DNA strand complementary to the following:TACTCT?
The double helix model of DNA suggested by Watson and Crick was exciting to the scientific community because?
What happens to the origin of replication once leading and lagging strands made on either side?
the attachment of nucleotides to form a complementary strand of Dna......................
what complementary strand of dna replication for agatgcatc and ctaggt?
What is an complementary strand?
Write a complementary strand of dna from: ATGGGGCCCCTATTGTAA?
4. Write the complementary (opposite match) DNA strand to AGGCTAGAC?
Which of the following is a correct complementary DNA strand to A-A-C-G-T-A-C?? please help?
Given the following DNA sequence, determine the complementary strand that would be added in replication.
Which of the following choices is an example of a mutation?
Which of the following occurs first during the process of transcription?
What is the complementary mRNA strand?
What determines the sequence of nitrogen bases on the complementary strand of DNA?
For this DNA strand, what is the complementary DNA strand and the mRNA strand transcribed from it?
Use this pnt strand of DNA to build a replicated DNA..
DNA Complementary Strands Verification (Python)?
Poll: Can you answer my question on genetics?
Which complementary pairs of nucleotides on the two strands bonded together?
One strand of a section of DNA reads:5' – TCGGACCTGAC – 3'. Which of the following would be the complementary?
I need some help on Biology, PLEASE help?
Suppose that a strand DNA were to have the following base sequence: TGGCAATCTG. Full question listed below...
does anyone have to answers to the DNA and Its Structure Data Sheet?
help with biology question?
DNA Complementary Strands Verification (Python)?
One strand of DNA has the following sequence 3' TACCTTCAGCGT 5', what is the complementary?
Primase synthesizes an RNA primer complementary to the leading strand correct?
What is the base sequence of a complementary strand of DNA that is ATT-CCG?
Which of the following is a complementary DNA strand? Please help!
A DNA strand with the sequence 3' GTGAACTGC 5' is complementary to the sequence:?
what is the composition dna from a strand if?
Complementary dna for the dna strand!!!
Explain Protein Synthesis?
biology help pls?
Which of the following statements about DNA replication is NOT correct?
Which of the following is a very important step in PCR?
What is the complementary half of this strand of DNA molecule by using the base-pair rule?
The polymerase chain reaction (PCR):?
HELP WITH DNA COMPLEMENTARY m-RNA STRAND?
Difference between complementary and identical DNA strands?
The complementary (inactive) DNA Strand for this active chain?
In single stranded nucleic acids like RNA, is complementary base pairing possible?
Which of the following statements best describes the replication of DNA?
whats the complementary strand of DNA when given one side of strand?
9a) Assume that the nitrogen base sequence in one of the strands in a DNA molecule is:?
If DNA's code is AATTGCGAT what would the complementary strand be? and mRNA code?
Explain Protein Synthesis?
Which PCR step synthesizes complementary DNA strands?
Which one of the following statements best describes the replication of DNA?
What is the complementary strand to 5’ GCAGTA 3’?
What is the Complementary DNA strand for TACGGGACACTCGA?
Complementary Strand of DNA?
3' TACAATGCCAGTGGTTCGCACATT 5', What is the base sequence on the complementary DNA strand?
Biology project. Gota make a DNA model. Got a sequence TACT...etc. is this one of the two helixes?
1.What is the complementary strand of GATTACATTATACCA?
I need to get the DNA complementary strand the mRNA the tRNA and the polypeptide from this coding strand TACTG?
Write out the complementary strand for this segment taken from a strand of DNA...??
If one strand of DNA has the following nucleotide sequence, find the correct complementary strand. 5'-CATTAGAT?
The base pairs on complementary strands of DNA held together by ____________________.
Newly synthesized DNA and its complementary strand?
What is the complementary strand to the following sequence? ATTGCC?
what is the complementary DNA (and RNA) strand for 3' TTT-GAC-ACT-5' and 3' GGG-AGA-CCA-5'?
What is the probability that you would find this sequence in a bacterial genome?
URGENT PLEASE HELP! Which strand of DNA would you use as a template to make raw mRNA?
What is an easy way of making complementary RNA strands from DNA?
DNA is comprised of two complementary polynucleotide stands. Why is this so significant?
Which of the following occurs first during the process of transcription?
In single stranded nucleic acids like RNA, is complementary base pairing possible?
What is the name of the enzyme that's responsible for reading the nucleotide bases on one strand...
What is the complementary nucleotides that would be inserted on a newly replicated strand of 5'-TAAACAT-3'?
What would be the disadvantage of having two DNA strands held by covalent bonds between the nucleotides?
what would be the complementary strand of the DNA strand 5' ACTGAGGAGTAG 3'?
What does this mean DNA polymerases emble complementary DNA strands on templates from free nucleotides?
If the sequence of bases on the sense strand of DNA is AATCCG, the complementary strand would be?
if the template of a strand of DNA is 5'AGATGCARC 3', the complementary strand will be.....
What would the complementary strand of DNA...
HELP PLEASE WITH THESE two BIOLOGY STRANDS?
what complementary strand of dna replication for agatgcatc and ctaggt?
One strand of DNA has the following base sequence: ATTGCG. What is the complementary DNA base sequence?
the complementary DNA strand sequence for 5'ATTGCTACCGAT3'?
biology...............
Restriction endonucleases especially useful if the generate "sticky" ends. What makes an end sticky?
what is this complementary strand of this DNA?
Which type of bond forms between complementary nucleotides, holding 2 facing strands of DNA together?
What type of bond holds complementary bases together of adjacent strands of DNA?
Is anyone good at chemistry? I've looked everywhere and read everthing and I cant find the answers to these.
8. The two strands in the DNA molecule contain nitrogen base?
A DNA strand with the sequence 3' GTGAACTGC 5' is complementary to the sequence?
After DNA replication is completed? and other questions. check my answers please?
Ok, so I'm reading about DNA and I don't quite understand the process of replication?
Which sequence is a DNA strand complementary to the original DNA strand?
Which of the following is NOT true of structure/function relationship of DNA?
RNA molecules destroyed if they have a sequence complementary to an introduced double stranded RNA is called..
What happens to the origin of replication once leading and lagging strands made on either side?
How do you put these steps of DNA replication in order?
3 Questions for Biology, related to DNA & RNA?
In DNA replication, each newly made strand is?
What is the complementary DNA strand to this sequence: CATGGA?
which of the following bases would you find in a complementary RNA strand?
What Would The Complementary Strand Of DNA Be For The Sequence Of Bases Below ?
I have searched and researched and have no clue please help?
What would be the disadvantage of having two DNA strands held by covalent bonds between the nucleotides?
why the two strands of the double helix described as complementary?
Identify if each of the following statements about transcription is true or false.
One strand of a double-helical DNA has the sequence 5' GCCAGTGATCCGGAT 3'?
Which complementary pairs of nucleotides on the two strands bonded together?
3' TACAATGCCAGTGGTTCGCACATT 5', What is the base sequence on the complementary DNA strand?
Predict the sequence of bases of the complementary strand to the nucleic acid?
DNA amplification by PCR question?
which description of DNA replication is correct?
What would be the sequence of bases on the complementary strand?
What is the coding strand for the Globin Gene?
Help with my science homework (finding a complementary strand of mRNA to match this strand of DNA)?
what is the complementarity strand of DNA for this equation?
DNA Complementary Strands Verification (Python)?
What is the complementary strand to 5’ GCAGTA 3’?
What would be the sequence of bases on the complementary strand?
The sequence of nitrogeneous bases on one strand of a DNA molecule is GGCAGTTCATGC. What would be the sequence
'Each exposed polynucleotide strand acts as a _____ to which complementary nucleotides attracted'?
What is the new synthesized complementary strand of this base sequence of the template strand of DNA?
Help with my science homework (finding a complementary strand of mRNA to match this strand of DNA)?
Need help with the DNA base sequence complementary to the strand TGCCAT?
some one please help im so confused with this?
The sequence pattern in which two complementary strands have the same sequence if they both read 5'?
What's an easy way to remember that the DNA strand sequence is read backwards?
What is the complementary nucleotides that would be inserted on a newly replicated strand of 5'-TAAACAT-3'?
Given the following DNA sequence, determine the complementary strand that would be added in replication: ATTGC
Which of the following is a complementary DNA strand? Please help!
which of the following bases would you find in a complementary RNA strand?
BIOLOGY HELP NEEDED! About DNA strands?
What is the base sequence of the complementary strand of DNA for the strand with the following sequence?
Given one strand of DNA: CAT ACG TTC CTA AAG ACG ATT, what would its complementary strand be?
The process by which dna is copied into a complementary strand of mrna?
The process by which dna is copied into a complementary strand of mrna?
Help with two questions about complementary DNA strands?
What is the probability that you would find this sequence in a bacterial genome?
If one strand of DNA had the sequence TAGGTAC, what would be the sequence of the complementary DNA strand?
Determine the DNA sequence that is complementary to the following DNA strand.
The active strand of the DNA reads?
a.b.c.d question!!
dna sequence determine the complementary strand that would be added in replication attgcatgatagcc?
What happens to the origin of replication once leading and lagging strands made on either side?
What is the new synthesized complementary strand of this base sequence of the template strand of DNA?
how do u make this into a complementary DNA strand and then into a messenger RNA strand?
Put the following events of transcription in chronological order.
If a strand of DNA is 30% guanine, how much uracil would be in the complementary RNA strand?
if the sequence in a one strand of dna is GCCATTAG , what is the complementary strand?
Biology Homework Help Please?
what would be the complementary strand of DNA for the following sequence of bases?
Which of the following is NOT a step in transcription?
How do I establish "terminal carbons" of complementary DNA strands?
What is the base sequence of a complementary strand of DNA that is ATT-CCG?
A strand of DNA contains the following bases: ATCGACT. What will be the the bases complementary DNA strand?
If one strand of DNA has the base sequence AAGCAA, the complementary strand has which of the following sequenc?
What is the Complementary DNA strand for TACGGGACACTCGA?
how is a complementary strand of dna made?
If the sequence of bases on the sense strand of DNA is AATCCG, the complementary strand would be?
Help on decoding dna strands?
What is the complementary strand for a DNA sequence of ATTAC?
Ap Biology multiple choice 10 easy points?
Write the DNA strand complementary to the following: TACTCT?
The relationship between strands of RNA and DNA is complementary?
The complementary (inactive) DNA Strand for this active chain?
Write the complementary strand of the DNA for ATCGTGAC.
Single-stranded ends generated by the same restriction enzyme complementary to each other?
what would the initial strand have to be if the complementary strand were CAT?
a strand of DNA contains the following basesATCGACT.
if one strand of DNA has the base sequence AAGCAA what is the complementary strand?
what would be the sequence of bases on the complementary strand?
What would be the correct order of transcription?
One strand of DNA has the following base sequence: ATTGCG. What is the complementary DNA base sequence?
Complementary DNA nucleotide sequences?
Someone please explain template strands to me. (mRNA tRNA Amino acids)?
What is the probability that you would find this sequence in a bacterial genome?
need help with some questions from my biology study sheets, i answered several but need verification/help!!
BIOLOGY Why the two strands of the double helix described as complementary?
BIOLOGY HELP NEEDED! About DNA strands?
4. Write the complementary (opposite match) DNA strand to AGGCTAGAC?
If one DNA strand has the sequence AGTTC what is the sequence if the opposite or complementary strand?
what would be the base sequence for the complementary DNA formed from the strand of DNA shown below?
hw help?Which of the following is a good reason for mRNA to be single-stranded,instead of double like DNA?
Does it matter which of the two complementary DNA strands is transcribed to form mRNA and why?
The active strand of the DNA reads?
Transcription of DNA...
what is the complementary strand for AGTCGACCCTTGAAATG?
Complementary Strand of DNA?
During DNA replication, a complementary strand..
If a stretch of DNA double helix has the sequence ACGTAACC, what is the sequence of the complementary region o?
what would be the sequence of bases on the complementary strand?
Determine the complementary bases for the following DNA strand: ACG TCG TAG CTG?
What is the mRNA, tRNA sequence, and what is the amino acid sequence for the following DNA strand?
Which sequence is an RNA strand complementary to the original DNA strand?
what is the complementary strand of AGTTC?
Who can help me with protein synthesis?
What is the complementary strand for a DNA sequence of ATTAC?
If this is one strand of DNA: TACGCGTCAATAACGCTA, what would the sequence of bases in its complementary strand?
If a DNA sequence was TAGC what would be the complementary strand?
What is the mRNA, tRNA sequence, and what is the amino acid sequence for the following DNA strand?
Determine the complementary strand of a DNA sequence?
Nitrogen-containing bases between two complementary DNA strands joined by what?
The following drawing shows the sequence of bases in one strand of a DNA molecule in a human cell?
What is the first step in transcription?
During protein synthesis complementary base pairs come together?
What is the function of reverse transcriptase in retroviruses?
Which of the following parts of DNA is probably the most important for its property of solubility?
what is the complementary strand, mRNa for template strand, and corresponding tRNa strand,and there amino acid?
The role of restriction enzymes in DNA technology is to?
in DNA replication, why is a G on the original strand patterned by a C on the complementary strand, and not?
Given the following DNA sequence, determine the complementary strand that would be added in replication.
Which of the following statements best describes the replication of DNA?
what is the complementary DNA strand to the sequence: 5-ATTGGCATGGAT-3?
Predict the sequence of bases of the complementary strand to the nucleic acid?
The phenomenon in which FNA molecules in a cell destroyed if they have a sequence complementary to an?
Based on what you learned in the activities, provide the appropriate complementary bases (nucleotides)?
What materials should I use and how should I set it up?
DNA replication, an old DNA strand with base sequence CATTAGACT?
Primase synthesizes an RNA primer complementary to the leading strand correct?
What type of bond holds complementary bases together of adjacent strands of DNA?
what is the complementary strand for the following DNA sequence: 5' GTACTA 3'?
One strand of a section of DNA reads:5' – TCGGACCTGAC – 3'. Which of the following would be the complementary?
again, to BIOLOGY people (About DNA)?
What holds complementary nitrogen bases to each other in a double strand of DNA?
what is the complementary strand, mRNa for template strand, and corresponding tRNa strand,and there amino acid?
Suppose that a strand DNA were to have the following base sequence: TGGCAATCTG. Full question listed below...
BIOLOGY QUESTION: what is the complementary DNA, mRNA strand, tRNA, and Amino Acid sequence?
Biology help please!
what is a complementary strand?
what is the complementary strand of the DNA sequence?
Retroviruses have a gene for reverse transcriptase that:?
Complementary DNA strands?
DNA is comprised of two complementary polynucleotide stands. Why is this so significant?
if the sequence of DNA was ATTCCG what is the sequence of the complementary strand?
8. The two strands in the DNA molecule contain nitrogen base?
What would the RNA strand that would be complementary to the following DNA strand be?
RNA complementary strand help?
Complementary DNA strands?
Which of the following occurs first during the process of transcription?
During DNA replication complementary base pairs come together. Which of the following is a correct complementa?
Which PCR step synthesizes complementary DNA strands?
What is the base sequence of the complementary strand of mRNA for the DNA strand with the following sequence?
What would be the coomplementary strand of DNA for this sequence?
what would be the complementary strand of DNA for the following sequence of bases?
The process by which dna is copied into a complementary strand of mrna?
Syntheses of a molecule of RNA that is complementary in sequence to one strand of DNA double helix is called:?
how is a complementary strand of dna made?
A strand of DNA contains the following bases: ATCGACT. What will be the the bases complementary DNA strand?
If one strand of DNA is TTAGGTCG, 1) then the sequence of complementary strand of DNA would be_.... Rna....!!
Which of the following is NOT a step in transcription?
BIOLOGY Why the two strands of the double helix described as complementary?
if the sequence in a one strand of dna is GCCATTAG , what is the complementary strand?
one strand of dna has the base sequence .....
1. Suppose one of the strands in your paper DNA model has the following sequence of bases:?
does anyone have to answers to the DNA and Its Structure Data Sheet?
DNA/RNA/protein synthesis:?
can you give the complementary DNA strand of ATT GCC AGC?
What is the function of reverse transcriptase in retroviruses?
given the following strand of mRNA make it's complementary DNA template and tRNA anticodons?
One strand of DNA has the following base sequence: ATTGCG. What is the complementary DNA base sequence?
what happens to the double helix in order for DNA to replicate?
what does it mean for a dna strand to be complementary?
what is the complementary strand, mRNa for template strand, and corresponding tRNa strand,and there amino acid?
what is the complementary strand of the DNA sequence?
What is the complementary strand to 5’ GCAGTA 3’?
if the restriction enzyme leaves complementary sequences on the ends of each piece of DNA it cuts, what will t?
Why the DNA duplex strands both antiparallel and complementary?
What is an easy way of making complementary RNA strands from DNA?
One strand of DNA has the following sequence 3' TACCTTCAGCGT 5', what is the complementary?
Can a probe be double-stranded?
what the correct initials of this complementary DNA strand C– –A– –G– –T– –G– –C– –A– –C– –T– –G– –C– –A
Newly synthesized DNA and its complementary strand?
I have searched and researched and have no clue please help?
Sequences of the bases in the two strands of DNA in relation to ends?
All of the following statements true about restriction enzymes EXCEPT?
3' TACAATGCCAGTGGTTCGCACATT 5', What is the base sequence on the complementary DNA strand?
Which of the following occurs first during the process of transcription?
5’- ATGCTATCATTGACCTTGAG*TTATTAA – 3 If DNA, what is the complementary strand?
how two DNA strands complementary?
help with question about complementary DNA strand?
How the two dna strands complementary?
What is an complementary strand?
what would be the complementary strand of the DNA strand 5' ACTGAGGAGTAG 3'?
1.What is the base sequence of the complementary strand of DNA for TACATGCGA?
does DNA polymerase synthesize new nucleotides and join them complementary to the template strand?
What is the matching mRNA strand?
During replication enzymes responsible for which of the following?
Biology and DNA mutations?
The following drawing shows the sequence of bases in one strand of a DNA molecule in a human cell?
Does the mRNA model more closely resemble the DNA strand that was transcribed or complementary?
provide the appropriate complementary bases (nucleotides) for the DNA strand?
A DNA strand has the following bases: TAC GAT. What is the COMPLEMENTARY strand of DNA?
The complementary (inactive) DNA Strand for this active chain?
One strand of a double-helical DNA has the sequence 5' GCCAGTGATCCGGAT 3'?
What is the sequence of the complementary strand of DNA? 5'ATGCACTGCCTTCTGGAATAG3'?
If a DNA has the Adenine, quanine, adenine, thymine, what will the complementary strand look like?
If a DNA Strand had the nucelotide sequence of 5'-ATGCGGCTAGAATATTCCA-3'?
does anyone have to answers to the DNA and Its Structure Data Sheet?
If the sequence of bases on the sense strand of DNA is AATCCG, the complementary strand would be?
some one please help im so confused with this?
Write the complementary strand of DNA?
give the complementary DNA strand for the following sequence : 5' - ATG CCG GTA ATA TTA ACC GCA TTA - 3'?
On which strand of DNA, the actual template strand or complementary partner, does the TATA box sequence occur?
If the nucleotide sequence of one strand of a DNA helix is GCCTAA...
Biology!!!!!PLEASE HELP!!10Points?
if the sequence of DNA was ATTCCG what is the sequence of the complementary strand?
Can you please translate this sentance to regular layman's term?
DNA braked into triplets. What would be the complementary strand read?
Having trouble on the DNA stranding material?
how do i find the complementary strand of DNA?
Write a sequence of bases that would be found in a complementary strand of DNA for this strand: ?
what would be the complementary strand of 5tm-ATT-GCG-TCA-ATT-ACG-CTA-3tm\?
Predict the sequence of bases of the complementary strand to the nucleic acid?
in reverse transcription, how the cDNA acts as primer for the formation of its complementary strand?
DNA and anticodon questions?
what is responsible for the conversation of the base sequence during dna replication?
Could someone help me write complementary mRNA strand with DNA?
if this is one strand of dna:TAGGACTCATT,what would its complementary strand be?
what is the complementary DNA strand to the sequence: 5-ATTGGCATGGAT-3?
does it matter which of the two complementary DNA strands is trascribed to form the messenger?
Which of the following is true about DNA Replication?
The active strand of the DNA reads?
If a DNA has the bases Adenine, guanine, adenine, thymine, what will the complementary strand look like?
What type of chemical bond joins the bases of complementary DNA strands?
help with question about complementary DNA strand?
If the sequence of one strand of DNA is CCCGGA, the sequence of the complementary strand will be:?
Which of the following is a very important step in PCR?
Complementary DNA strands..Help?
Which of the following is a DNA strand complementary to CGA ATC AGC?
What is the base sequence of the complementary strand of DNA for the strand with the following sequence?
some one please help im so confused with this?
What does it mean when we say that DNA strands complementary?
what's the complementary DNa strand of 5'-TTAGGCTTGCGATGCA-3'?
During DNA replication, a complementary strand of DNA is made for each original DNA strand. ..
What's the complementary strand of 5'TATACGGCAATG'3?
What is the nucleotide sequence of this DNA strand?
1. What is the function of restriction enzymes that naturally occur in bacterial cells?
Determine the DNA sequence that is complementary to the following DNA strand CGGCCTTCAATAGGTCCCAAA?
What would the complementary strand of DNA be for the following sequence of bases? ACCTAGTTG urgent!!!!!!!!!
Need help what is this DNA strands complementary sequence?
Write a sequence of bases that would be found in a complementary strand of DNA for this strand: ?
Restriction endonucleases especially useful if the generate "sticky" ends. What makes an end sticky?
DNA question involoving transcription and mRNA?
Why is it essential fro dna to have two complementary strands?
In DNA replication, each newly made strand is?
Which sequence is a DNA strand complementary to the original DNA strand?
why is it important that DNA is composed of two complementary polynucleotide strands?
9. Why don’t DNA template strands reanneal with one another during the annealing cycle of PCR?
what is the complementary strand for AGTCGACCCTTGAAATG?
Dtermine the DNA sequence that is complementary to the following DNA strand. CGCCCTTCAATAGGTCCCTAA?
4. Write the complementary (opposite match) DNA strand to AGGCTAGAC?
9a) Assume that the nitrogen base sequence in one of the strands in a DNA molecule is:?
what is the complementary DNA (and RNA) strand for 3' TTT-GAC-ACT-5' and 3' GGG-AGA-CCA-5'?
All of the following statements true about restriction enzymes EXCEPT?
The 2 strands of DNA complementary? Explain this.
how do u make this into a complementary DNA strand and then into a messenger RNA strand?
Biology and DNA mutations?
what is the complementary DNA strand for AACGTTGAC?
Which of the following is NOT true of structure/function relationship of DNA?
if a strand of dna had the following necleotide sequence, what's its complementary strand?
During DNA replication, a complementary strand of DNA is made for each original DNA strand. ..
A DNA strand with the sequence 3' GTGAACTGC 5' is complementary to the sequence?
DNA question involoving transcription and mRNA?
what would be the base sequence for the complementary DNA formed from the strand of DNA shown below?
What would be the coomplementary strand of DNA for this sequence?
DNA replication, an old DNA strand with base sequence CATTAGACT?
Complementary sequence of the following........ Help please!
DNA synthesis questions. Check my answers please. dont know a few?
a.b.c.d question!!
Which of the following occurs first during the process of transcription?
How is MRNA single stranded when it is added to a complementary DNA strand?
The relationship between strands of RNA and DNA is complementary?
How to fill in a complementary strand of DNA?
Write a sequence of bases that would be found in a complementary strand of DNA for this strand: ?
can you give the complementary DNA strand of ATT GCC AGC?
HELP with biology i need help finding the complementary strands to these template strands?
How do you find the complementary bases ,nucleotides, for the DNA strand AATCGGATCGTTACC?
Retroviruses have a gene for reverse transcriptase that:?
What would be the sequence of bases on the complementary strand?
On which strand of DNA, the actual template strand or complementary partner, does the TATA box sequence occur?
Can a probe be double-stranded?
Write a complementary strand od dna from: ATGGGGCCCCTATTGTAA?
n a DNA double helix an adenine of one strand always pairs with a ? of the complementary strand, and a...
During DNA replication, a complementary strand..
If DNA's code is AATTGCGAT what would the complementary strand be? and mRNA code?
Which of the following is a complementary DNA strand? Please help!
which of the following bases would you find in a complementary RNA strand?
What is the complementary DNA Strand: ATGGCGCGTTATACGCCC?
Which of the following is most similar to a DNA probe?
Choose the first three nucleotides of the complementary RNA strand?
Choose the first three nucleotides of the complementary RNA strand?
if one strand of DNA has the base sequence AAGCAA what is the complementary strand?
what is the complementary strand of AGTTC?